For Primerdesign and Primer Database management we use the java-based program SeqState. Please find the program and corresponding manual here.
Shown here are only already publicated Primers for different genomic regions, seperated in three groups, one for trnK/matK region,
one for the trnT-L-F region and one for all other currently used regions.

Our database comprises a current (19/10/2007) count of 275 Primers.

Primer Database: – download the SeqState .prs file of publicated (98) Primers here

name 5'->3' sequence
orientation
designed by used for
target region
publication
atpB-3`F GTGGAAACCCCGGGACGAGAAGTAGT
F
Hodges and Arnold (1994) angiosperms
atpB
Hodges and Arnold (1994)
atpb-o12 GAAGTAGTAGGATTGATTCTC
F
Samuel et al (1997) angiosperms
atpB
Samuel et al (1997)
ITS4 TCCTCCGCTTATTGATATGC
R
White et al (1990) angiosperms
ITS
White et al (1990)
ITS5 GGAAGTAAAAGTCGTAACAAGG
F
White et al (1990) angiosperms
ITS
White et al (1990)
ITS5bryo TCCTCCGCTTAGTGATATGC
F
Quandt (2001) bryophytes
ITS
Quandt (2001)
HEpetD-343R TTCTTCTTTAGATCCCTTG
R
Worberg (2005) internal Helicia
petD
Worberg et al. (2007)
MONpetD738R AATTTWGCTCTTAATACAGG
R
Löhne and Borsch (2002) Monimiaceae
petD
Löhne and Borsch (2005)
PIpetB1365F TTGACYCGTTTTTATAGTTTAC
F
Löhne and Borsch (2002) angiosperms
petD
Löhne and Borsch (2005)
PIpetB1411F GCCGTMTTTATGTTAATGC
F
Löhne and Borsch (2002) angiosperms
petD
Löhne and Borsch (2005)
PIpetD346R TCTTCCTYAGATCCC
R
Löhne and Borsch (2002) angiosperms
petD
Löhne and Borsch (2005)
PIpetD738R AATTTAGCYCTTAATACAGG
R
Löhne and Borsch (2002) angiosperms
petD
Löhne and Borsch (2005)
rbcL-1460R CTTTTAGTAAAAGATTGGGCCGAG
R
Chase et al (1993) angiosperms
rbcL
Chase et al (1993)
rbcL-1F ATGTCACCACAAACAGAAACTAAAGC
F
Chase et al (1993) angiosperms
rbcL
Chase et al (1993)
rbcL-o15 TACAGTTGTCCATGTACCAG
F
Olmstead angiosperms
rbcL
Olmstead
rpl16F CTATGCTTAGTGTGTGACTC
F
Campagna and Downie (1998) angiosperms
rpl16
Campagna and Downie (1998)
rpl16R TCTTCCTCTATGTTGTTTACG
R
Campagna and Downie (1998) angiosperms
rpl16
Campagna and Downie (1998)
Primers for the trnK/matK region
ACmatK100F CTCGACTGTATCAACAGAATC
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK105F GAATGAATGGAAAAAACAGCATG
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1200R AGGTATTAATATATCTAACAC
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1250F CTCATTATTATAGTGGCTCYTC
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1252R TGAGAATTGATCCTCTAAAAAAGG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
Acmatk1300R TRCGAGACAAAGTTCTAGCAG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1400R GGATTCGTATTCACATACA
R
Quandt (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1426R AAAGGAAATGGATTCTTTTGG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1497R CATCTTTCACCCAGGGAAG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1530R ATAAAGAAAGAATCGTAATAAATG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1746F CTTCAAAAGGGACATCTCTTCTG
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1809F AATGTTATTTTTCTGTGTGGTCTC
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1860R GAATCGCACACTTGAAAGAAAACC
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK1983F TAAAAAATTCGATACCATAGTTCC
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK200R GAATTTCCACAATGACTGC
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK2080R GTCCAAATCGGTCAATAATATC
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK2113F TCAGTAATACGGAGTCAAATG
F
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK2231R TCTTCCAAAAATTCTGAACCT
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK500F TTCTTCTTTGCATTTATTACG
F
Kai Mueller (2002) Amaranthaceae
matK
Hilu et al. (2003)
ACmatK634R ATAGGAACAAGAATAATCT
R
Kai Mueller (2001) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatk650r GGATTCATATTCACATACATRG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatk700R TCCGTAGAAATGKATTCGTTC
R
Quandt (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK871R TATTCCTGAAAGATAAGTGGATAG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK873R ATATACTCCTGAAAGAGAAGTGG
R
Kai Mueller (2002) Amaranthaceae
matK
Müller and Borsch (2005)
ACmatK975F ATACAGTTTACTAATWGTRAAACG
F
Wanke (2001) Amaranthaceae
matK
Müller and Borsch (2005)
ALImatK470F CCSTATCCCATTCATCTCG
F
Wanke (2001) Alismataceae
matK
Hilu et al. (2003)
ARAmatK480F CATCTCGAAATCTTGGTTC
F
Wanke (2001) Araceae
matK
Hilu et al. (2003)
DIDYmatK-1035R CGAACTCGTAAAGACTCGA
R
Worberg (2005) Didymeles
matK
Worberg et al. (2007)
DIDYmatK-1107F CAATTACTCCTCTGATTGGATC
F
Worberg (2005) Didymeles internal
matK
Worberg et al. (2007)
DIDYmatk-570F CGAGTATCAGAACTGGAG
F
Worberg (2005) Didymeles
matK
Worberg et al. (2007)
EUPTmatK-1006F GGCTATCTTTCAAGTGTACG
F
Worberg (2005) Euptelea
matK
Worberg et al. (2007)
GNmatK1056R TCCCTGGTAATGAACTCTGC
R
Borsch (2001) Gnetales
matK
Hilu et al. (2003)
Le1R ATAGAAATAGATTCGTTC
R
Kai Mueller (2001) Lentibulariaceae
matK
Müller et al. (2004)
Le2F TGGTACGGAGTCAAAKTC
F
Kai Mueller (2001) Lentibulariaceae
matK
Müller et al. (2004)
Le3F ACCAATCCTTTCATTTACG
F
Kai Mueller (2001) Lentibulariaceae
matK
Müller et al. (2004)
Le4R TTCGCCTGAAAATCCGTAACC
R
Kai Mueller (2001) Lentibulariaceae
matK
Müller et al. (2004)
Le7F GGGTTGCTAACTCAACGGTAG
F
Kai Mueller (2001) Lentibulariaceae
matK
Müller et al. (2004)
MATKFA490F GAAATCTTGGTTCAAAYCCTTCG
F
Kai Mueller (2001) angiosperms
matK
Hilu et al. (2003)
MATKGE490F ATCTTGGTTCAAACYCTTCGC
F
Kai Mueller (2001) angiosperms
matK
Hilu et al. (2003)
MG1 AACTAGTCGGATGGAGTAGAT
R
Liang and Hilu (1996) angiosperms
matK
Liang and Hilu (1996)
MG15 ATCTGGGTTGCTAACTCAATG
F
Liang and Hilu (1996) angiosperms
matK
Liang and Hilu (1996)
NYmatK_180R TAAGCGTTTCACAATTAGTG
R
Borsch (2000) Nymphaeales
matK
Borsch (2000)
NYmatK480F CATCTGGAAATCTTGSTTC
F
Borsch (2000) Nymphaeales
matK
Borsch (2000)
PI-matK-1060F ACTTRTGGTCTCAAC
F
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
PI-matK-1480F TCGTAAACAYAAAAGTAC
F
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
PI-matK-370R TTTYCCTATAATTGGAGC
R
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
Pi-matK-470F TTCAAACCCTTCGYTRCTGG
F
Wanke (2001) Piperaceae
matK
Hilu et al. (2003)
PI-matK-500F TTTGCATTTATTGCGAATC
F
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
PI-matK-560F TGGATACAAGATGTTCCC
F
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
PI-matK-700R ATRAGAAGATTGTTTACGG
R
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
PI-matK-730R ATAGAAATGGAYTCGTTCAAG
R
Wanke and Borsch (2001) Piperaceae
matK
Wanke et al. (2006)
PRmatK521F TTCYTTGCATTTATTGCGATTC
F
Borsch (2001) angiosperms
matK
Hilu et al. (2003)
psbA-R CGCGTCTCTCTAAAATTGCAGTCAT
R
Steele and Vilgalys (1994) angiosperms
matK
Steele (1995)
RAmatK470F ACCCTACCCYATCCATCTG
F
Kai Mueller (2001) angiosperms
matK
Hilu et al. (2003)
RAmatK670F CCRTATTTGTTTTTCTCCG
F
Borsch (2001) angiosperms
matK
Hilu et al. (2003)
ROSmatK-530F AGATGCCTCTTCTTTGC
F
Worberg (2006) rosid matK internal
matK
Worberg et al. (2007)
ROSmatK-655R GGATTCGTATTCACATACAT
R
Worberg (2006) rosid matK internal
matK
Worberg et al. (2007)
TOmatK480F CATCTKGAAATCTTGGTTC
F
Borsch (2001) angiosperms
matK
Hilu et al. (2003)
Wel-matK TACTTAATACGATCGAAATATGC
F
Wanke and Borsch (2001) Welwitschia
matK
Hilu et al. (2003)
Za-matK AATGGAAGATGCTTCTCC
F
Wanke and Borsch (2001) Zamia
matK
Hilu et al. (2003)
trnK1280R ATAAAAGCAAACCCCTCTG
R
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1280RA ATAACAGCAAACCCTTCTG
R
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1280RB ATACAAACAAAAACCTCTG
R
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1580F TACGATTCTTTCTCAGCG
F
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1580FC TACGATTCTTGCTCAACG
F
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1590R CTCGCTGAGAAAGAATCG
R
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1800F ACGATCAACATCTTCTGGAG
F
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK1800R AAATGAAAGGAGTGGTTGC
R
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK2000F CCTGAATAAATGGAAATG
F
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK2050F TTTTCCTTGTGGTTTCCTG
F
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK2450R CTTTGTGTTTCCGAGCC
R
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK2600F GTCGGATTTGGTATTTGG
F
Kai Mueller (2001) angiosperms
trnK
Müller et al. (2004)
trnK2R AACTAGTCGGATGGAGTAG
R
Johnson and Soltis (1995) angiosperms
trnK
Johnson and Soltis (1995)
Primers for the trnT-L-F region
trnL-110R GATTTGGCTCAGGATTGCCC
R
Wanke and Borsch (2001) angiosperms
trnT-F
Borsch et al. (2003)
trnL-460F GAGAATAAAGATAGAGTCC
F
Worberg (2005) angiosperms
trnT-F
Worberg et al. (2007)
trnTa CATTACAAATGCGATGCTCT
F
Taberlet et al (1991) angiosperms
trnT-F
Taberlet et al (1991)
trnTB TCTACCGATTTCGCCATATC
R
Taberlet et al (1991) angiosperms
trnT-F
Taberlet et al (1991)
trnTc CGAAATCGGTAGACGCTACG
F
Taberlet et al (1991) angiosperms
trnT-F
Taberlet et al (1991)
trnTd GGGGATAGAGGGACTTGAAC
R
Taberlet et al (1991) angiosperms
trnT-F
Taberlet et al (1991)
trnTe GGTTCAAGTCCCTCTATCCC
F
Taberlet et al (1991) angiosperms
trnT-F
Taberlet et al (1991)
trnTf ATTTGAACTGGTGACACGAG
R
Taberlet et al (1991) angiosperms
trnT-F
Taberlet et al (1991)